Prev. |  KEGG KO K04354 > 

RIKEN DNA Bank Human Resource - PPP2R2B

Gene ID NCBI Gene 5521 |  KEGG hsa:5521
Gene Symbol PPP2R2B
Protein Name protein phosphatase 2 regulatory subunit Bbeta
Synonyms B55BETA|PP2AB55BETA|PP2ABBETA|PP2APR55B|PP2APR55BETA|PR2AB55BETA|PR2ABBETA|PR2APR55BETA|PR52B|PR55-BETA|PR55BETA|SCA12
Ortholog resources KEGG ortholog (KEGG orthology K04354) in the DNA Bank
Featured content Hippo signaling (human)
Featured content Sphingolipid signaling pathway (human)
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX011957 IRAK029O21 pCMV-SPORT6 BC031790 NM_181675 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR181750 ARi54G06 pGCAP10 NM_004576.2  
GAGCCGCCTCCAGCCTCCTGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl