Prev. | NRCD Clone W | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07591

HP ID(1) HP07591
Gene ID(2) 57599
Gene Symbol finder WDR48
Protein Name WD repeat domain 48
RefSeq NM_020839.2
Length of RefSeq (bp) 3705
Chromosome 3p21.33
Reference DDBJ accession
UniGene Hs.109778

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi52F09 pGCAP10 GATGCAAGATGGCGGCCCATCACCGGCAGAACACAGCAGGGCGGAGGAAAGTGCAGGTTT
RBd31C05 pGCAP10 GGGAGTGTCAACATGCAAGATGGCGGCCCATCACCGGCAGAACACAGCAGGGCGGAGGAA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl