Prev. |  KEGG KO K15361 > 

RIKEN DNA Bank Human Resource - WDR48

Gene ID NCBI Gene 57599 |  KEGG hsa:57599
Gene Symbol WDR48
Protein Name WD repeat domain 48
Synonyms P80|SPG60|UAF1
Ortholog resource in our bank

  WDR48

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR180929 ARi52F09 pGCAP10 NM_020839.2  
GATGCAAGATGGCGGCCCATCACCGGCAGAACACAGCAGGGCGGAGGAAAGTGCAGGTTT
HKR372453 RBd31C05 pGCAP10 NM_020839.2  
GGGAGTGTCAACATGCAAGATGGCGGCCCATCACCGGCAGAACACAGCAGGGCGGAGGAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.09.29

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl