Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07579

HP ID(1) HP07579
Gene ID(2) 80025
Gene Symbol finder PANK2
Protein Name pantothenate kinase 2
RefSeq NM_024960.4
Length of RefSeq (bp) 1712
Chromosome 20p13
Reference DDBJ accession
UniGene Hs.516859

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi51B12 pGCAP10 GGCTCTGGCTGGACTGCCGCGGAGGAGGCGAGAAGGAATCCGACGCTGGGGGGCTTGCTC
RBd84F06 pGCAP10 GGGCCGGCCGAGGGCGCGCCTCTGCTCTGGCTGGACTGCCGCGGAGGAGGCGAGAAGGAA
RBd84F09 pGCAP10 GAGGCGCCTGCGCAGAGCCGCGCGTTGGCCTCCTGTTCCGCTTAAAGGGGCGGTGCAGAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl