Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07572

HP ID(1) HP07572
Gene ID(2) 83452
Gene Symbol finder RAB33B
Protein Name RAB33B, member RAS oncogene family
RefSeq NM_031296.1
Length of RefSeq (bp) 3876
Chromosome 4q28
Reference DDBJ accession
UniGene Hs.591679

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi50E09 pGCAP10 GGGGCGCGCGCTCTTGCGGTGGCGTAATCTCTCAGCCTTTCTGTGTCTCCTTTCCTCCGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl