Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07559

HP ID(1) HP07559
Gene ID(2) 79837
Gene Symbol finder PIP5K2C
Protein Name phosphatidylinositol-4-phosphate 5-kinase, type II, gamma
RefSeq NM_024779.4
Length of RefSeq (bp) 3229
Chromosome 12q13.3
Reference DDBJ accession
UniGene Hs.144502

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi48A11 pGCAP10 GGCTTCCGGGGTCGGGCGCCTGGATAGCTGCCGGCTCCGGCTTCCACTTGGTCGGTTGCG
ARi65C12 pGCAP10 GGAGCGCCGCTTCGGNTCGGGCGCCTGNATAGCTGCCGGCTCGGCTCNCTTGTCGGTGCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl