Prev. |  KEGG KO K00920 > 

RIKEN DNA Bank Human Resource - PIP4K2C

Gene ID NCBI Gene 79837 |  KEGG hsa:79837
Gene Symbol PIP4K2C
Protein Name phosphatidylinositol-5-phosphate 4-kinase type 2 gamma
Synonyms PIP5K2C
Ortholog resources KEGG ortholog (KEGG orthology K00920) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY018706 IRAK046M18 pBluescriptR BC028596 NM_024779

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR179211 ARi48A11 pGCAP10 NM_024779.4  
GGCTTCCGGGGTCGGGCGCCTGGATAGCTGCCGGCTCCGGCTTCCACTTGGTCGGTTGCG
HKR186060 ARi65C12 pGCAP10 NM_024779.4  
GGAGCGCCGCTTCGGNTCGGGCGCCTGNATAGCTGCCGGCTCGGCTCNCTTGTCGGTGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.16

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl