Prev. | NRCD Clone B | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07551

HP ID(1) HP07551
Gene ID(2) 25825
Gene Symbol finder BACE2
Protein Name beta-site APP-cleaving enzyme 2
RefSeq NM_012105.3
Length of RefSeq (bp) 2993
Chromosome 21q22.3
Reference DDBJ accession
UniGene Hs.529408

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi37H10 pGCAP10 GTCCCGTCCTCCCCGCCGCCGCCGGTCCCGGTGCGCGCCCATCCCTGCCCGCAGCCCCGC
ARi46H05 pGCAP10 AACTCCCGTCCTCCCCGCCGCCGCCGGTCCCGGTGCGCGCCCATCCCTGCCCGCAGCCCC
ARi64G12 pGCAP10 GCCCGGTGNGCGCCCATCCCTGCCCGCAGCCCCGCGCGCCGGCCGAGTCGCTGAGCCGCGGCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl