Prev. |  KEGG KO K07747 > 

RIKEN DNA Bank Human Resource - BACE2

Gene ID NCBI Gene 25825 |  KEGG hsa:25825
Gene Symbol BACE2
Protein Name beta-site APP-cleaving enzyme 2
Synonyms AEPLC|ALP56|ASP1|ASP21|BAE2|CDA13|CEAP1|DRAP
Ortholog resources KEGG ortholog (KEGG orthology K07747) in the DNA Bank
Featured content Alzheimer disease - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY093886 IRAL034L22 pOTB7 BC014453 NM_012105 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE007707 W01A019E11 pENTR-TOPO IRAL034L22 BC014453 NM_012105  
HGE007711 W01A019E15 pENTR-TOPO IRAL034L22 BC014453 NM_012105  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR174978 ARi37H10 pGCAP10 NM_012105.3  
GTCCCGTCCTCCCCGCCGCCGCCGGTCCCGGTGCGCGCCCATCCCTGCCCGCAGCCCCGC
HKR178573 ARi46H05 pGCAP10 NM_012105.3  
AACTCCCGTCCTCCCCGCCGCCGCCGGTCCCGGTGCGCGCCCATCCCTGCCCGCAGCCCC
HKR185756 ARi64G12 pGCAP10 NM_012105.3  
GCCCGGTGNGCGCCCATCCCTGCCCGCAGCCCCGCGCGCCGGCCGAGTCGCTGAGCCGCGGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.05.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl