Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07547

HP ID(1) HP07547
Gene ID(2) 51444
Gene Symbol finder RNF138
Protein Name ring finger protein 138
RefSeq NM_016271.3
Length of RefSeq (bp) 3566
Chromosome 18q12.1
Reference DDBJ accession
UniGene Hs.302408

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi46D11 pGCAP10 GGGGTTCATGTAGGGAGTCGGGCCCCGGGCCGCCACCGTCACCTCGGCCGCTGCCGCTGT
RBd66F02 pGCAP10 GCCCAGATCCCCGGCGCTCCCGCGTTCGGTGACGGCCGGGTAGGCTGTAGGCAGCGCAAT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl