Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07543

HP ID(1) HP07543
Gene ID(2) 112858
Gene Symbol finder TP53RK
Protein Name TP53 regulating kinase
RefSeq NM_033550.3
Length of RefSeq (bp) 3384
Chromosome 20q13.2
Reference DDBJ accession
UniGene Hs.440263

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi45G06 pGCAP10 GAGAGACAGCTGATCGGTTGGAGCTGTTGCGCCGAGCAGTCATGGCGGCGGCCAGAGCTA
RBdS104L16 pGCAP10 GAGAGNNNGCTGATCGGTTGGAGCTCTTGCGCCGAGCAGTCATGGCGGCGGCTAGAGCTA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl