Prev. |  KEGG KO K08851 > 

RIKEN DNA Bank Human Resource - TP53RK

Gene ID NCBI Gene 112858 |  KEGG hsa:112858
Gene Symbol TP53RK
Protein Name TP53 regulating kinase
Synonyms BUD32|C20orf64|GAMOS4|Nori-2|Nori-2p|PRPK|TPRKB|dJ101A2
Ortholog resources KEGG ortholog (KEGG orthology K08851) in the DNA Bank
Featured content Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX005874 IRAK014L10 pCMV-SPORT6 BC009727 NM_033550 Full
HGY067208 IRAK168A08 pBluescriptR BC066309 NM_033550 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR178150 ARi45G06 pGCAP10 NM_033550.3  
GAGAGACAGCTGATCGGTTGGAGCTGTTGCGCCGAGCAGTCATGGCGGCGGCCAGAGCTA
HKR441880 RBdS104L16 pGCAP10 NM_033550.3  
GAGAGNNNGCTGATCGGTTGGAGCTCTTGCGCCGAGCAGTCATGGCGGCGGCTAGAGCTA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl