RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - TP53RK

Gene ID	NCBI Gene 112858 \| KEGG hsa:112858
Gene Symbol	TP53RK
Protein Name	TP53 regulating kinase
Synonyms	BUD32\|C20orf64\|GAMOS4\|Nori-2\|Nori-2p\|PRPK\|TPRKB\|dJ101A2
Featured content	Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.

Ortholog resource in our bank

  TP53RK

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	Sequence		CDS status⁽²⁾
Catalog number	Clone name	Vector	Submitted (DDBJ)⁽¹⁾	Refered (NCBI mRNA)	CDS status⁽²⁾
HGX005874	IRAK014L10	pCMV-SPORT6	BC009727	NM_033550	Full
HGY067208	IRAK168A08	pBluescriptR	BC066309	NM_033550	Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	mRNA RefSeqs/DDBJ accession⁽¹⁾
Catalog number	5'-terminal sequence⁽²⁾
HKR178150	ARi45G06	pGCAP10	NM_033550.3
HKR178150	GAGAGACAGCTGATCGGTTGGAGCTGTTGCGCCGAGCAGTCATGGCGGCGGCCAGAGCTA
HKR441880	RBdS104L16	pGCAP10	NM_033550.3
HKR441880	GAGAGNNNGCTGATCGGTTGGAGCTCTTGCGCCGAGCAGTCATGGCGGCGGCTAGAGCTA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv

2022.09.29

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl