Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07525

HP ID(1) HP07525
Gene ID(2) 26030
Gene Symbol finder PLEKHG3
Protein Name pleckstrin homology domain containing, family G (with RhoGef domain) member 3
RefSeq NM_015549.1
Length of RefSeq (bp) 4418
Chromosome 14q23.3
Reference DDBJ accession
UniGene Hs.509637

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi43B09 pGCAP10 GTTCCTGCCGGGCGCTGGCAAGCCGCGCGCTGCCTGGGGTCTCCGGGGGCCGCGCTTGCA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl