Prev. | 

RIKEN DNA Bank Human Resource - PLEKHG3

Gene ID NCBI Gene 26030 |  KEGG hsa:26030
Gene Symbol PLEKHG3
Protein Name pleckstrin homology and RhoGEF domain containing G3
Synonyms ARHGEF43|KIAA0599
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX053943 IRAK134O07 pCMV-SPORT6 BC063554 NM_015549 Partial/var
HGX066505 IRAK166E09 pCMV-SPORT6 BC073907 NM_015549 Partial/var
HGY085439 IRAL013J23 pOTB7 BC004298 NM_015549 Partial/var
HGY091350 IRAL028G06 pOTB7 BC011891 NM_015549 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR177233 ARi43B09 pGCAP10 NM_015549.1  
GTTCCTGCCGGGCGCTGGCAAGCCGCGCGCTGCCTGGGGTCTCCGGGGGCCGCGCTTGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl