Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07508

HP ID(1) HP07508
Gene ID(2) 9867
Gene Symbol finder PJA2
Protein Name praja ring finger 2
RefSeq NM_014819.4
Length of RefSeq (bp) 4878
Chromosome 5q21.3
Reference DDBJ accession
UniGene Hs.483036

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi40E07 pGCAP10 GGGGAGGAGTTGGAGGCGGAGAAGAAGGCGGTGGTGGCGGGTGGAGGTCCNAGCGTTGNT
RBdS154F18 pGCAP10 ACCGCCGCCGCCGCCGCCACAGCCGCCAGCCGCTTCGCGTTCGGCGGGGGAGGAGTTGGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl