Prev. |  KEGG KO K10634 > 

RIKEN DNA Bank Human Resource - PJA2

Gene ID NCBI Gene 9867 |  KEGG hsa:9867
Gene Symbol PJA2
Protein Name praja ring finger ubiquitin ligase 2
Synonyms Neurodap1|RNF131
Ortholog resources KEGG ortholog (KEGG orthology K10634) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY013038 IRAK032J22 pBluescriptR BC030826 NM_014819 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE089220 M01C023A20 pDONR221 MGC01-B10 BC030826 ENST00000361557 done
HGE089268 M01C023C20 pDONR221 MGC01-B10 BC030826 ENST00000361557  
HGE089316 M01C023E20 pDONR221 MGC01-B10 BC030826 ENST00000361557  
HGE089364 M01C023G20 pDONR221 MGC01-B10 BC030826 ENST00000361557  
HGE089412 M01C023I20 pDONR221 MGC01-B10 BC030826 ENST00000361557  
HGE089460 M01C023K20 pDONR221 MGC01-B10 BC030826 ENST00000361557  
HGE089508 M01C023M20 pDONR221 MGC01-B10 BC030826 ENST00000361557  
HGE089556 M01C023O20 pDONR221 MGC01-B10 BC030826 ENST00000361557  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR176103 ARi40E07 pGCAP10 NM_014819.4  
GGGGAGGAGTTGGAGGCGGAGAAGAAGGCGGTGGTGGCGGGTGGAGGTCCNAGCGTTGNT
HKR461738 RBdS154F18 pGCAP10 NM_014819.4  
ACCGCCGCCGCCGCCGCCACAGCCGCCAGCCGCTTCGCGTTCGGCGGGGGAGGAGTTGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl