Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07506

HP ID(1) HP07506
Gene ID(2) 9991
Gene Symbol finder ROD1
Protein Name ROD1 regulator of differentiation 1 (S. pombe)
RefSeq NM_005156.4
Length of RefSeq (bp) 7230
Chromosome 9q32
Reference DDBJ accession
UniGene Hs.269988

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi40D10 pGCAP10 GACTCTCCTTCCACCTCGGACCGGCCGGGGCTCCGCAGAGCCAAAGCTCGCTTGTCCCCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl