Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07494

HP ID(1) HP07494
Gene ID(2) 5567
Gene Symbol finder PRKACB
Protein Name protein kinase, cAMP-dependent, catalytic, beta
RefSeq NM_002731.2
Length of RefSeq (bp) 4529
Chromosome 1p36.1
Reference DDBJ accession
UniGene Hs.487325

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi55A12 pGCAP10 GGCNCTAAGGGGGAGTGTCTGCCCGCCGCCGCCACTGCTGCTGCCACCGCCGTCGCCGCC
ARi65B03 pGCAP10 GGTCGCCGCCGCCGCCGCCGCCGCCGCTGCTGCTGCCGGTGCTANNNGTTCGCTGGAGCC
ARiS045K07 pGCAP10 GGCGCGAANGGGGAGTGTCTGCCCNCCGCCGCCACTGCTGCTGCCACCGCCGTCGCCGCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl