Prev. |  KEGG KO K04345 > 

RIKEN DNA Bank Human Resource - PRKACB

Gene ID NCBI Gene 5567 |  KEGG hsa:5567
Gene Symbol PRKACB
Protein Name protein kinase cAMP-activated catalytic subunit beta
Synonyms PKA C-beta|PKACB
Ortholog resources KEGG ortholog (KEGG orthology K04345) in the DNA Bank
Featured content Hedgehog signaling (human)
Featured content Wnt signaling pathway (human)
Featured content Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.
Featured content Parkinson disease - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB04103 pAxCALNLhPRKACB Shuttle vector to generate rAd harboring human PRKACB
RDB03523 pAxCALNLhPRKACB (forward) Shuttle vector to generate rAd harboring human PRKACB (forward)

RDB_org_190226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX006254 IRAK015K14 pCMV-SPORT6 BC016285 NM_207578 Full
HGY029329 IRAK073F09 pBluescriptR BC035058 NM_002731 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE021339 W01A053F19 pENTR-TOPO IRAK015K14 BC016285 NM_207578  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR182012 ARi55A12 pGCAP10 NM_002731.2  
GGCNCTAAGGGGGAGTGTCTGCCCGCCGCCGCCACTGCTGCTGCCACCGCCGTCGCCGCC
HKR186027 ARi65B03 pGCAP10 NM_002731.2  
GGTCGCCGCCGCCGCCGCCGCCGCCGCTGCTGCTGCCGGTGCTANNNGTTCGCTGGAGCC
HKR218247 ARiS045K07 pGCAP10 NM_002731.2  
GGCGCGAANGGGGAGTGTCTGCCCNCCGCCGCCACTGCTGCTGCCACCGCCGTCGCCGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.05.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl