Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07466

HP ID(1) HP07466
Gene ID(2) 6049
Gene Symbol finder RNF6
Protein Name ring finger protein (C3H2C3 type) 6
RefSeq NM_183043.1
Length of RefSeq (bp) 3284
Chromosome 13q12.2
Reference DDBJ accession
UniGene Hs.136885

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS023F01 pGCAP10 GGTTACTTGAGGCTCGGTTGGGAAGAGATGGTCAGCTCTCAAAAAAGGCACAAACAATTG
RBd63D12 pGCAP10 GAAGTGGGCGGCGTGGCTGTCGGGAAAGAAGGGCTGGGGCCTGCCGTTCTTCCTCCCGAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl