Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07436

HP ID(1) HP07436
Gene ID(2) 715
Gene Symbol finder C1R
Protein Name complement component 1, r subcomponent
RefSeq NM_001733.4
Length of RefSeq (bp) 2526
Chromosome 12p13
Reference DDBJ accession
UniGene Hs.524224

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi56D06 pGCAP10 GATTCCCTCCAACATTCCTCCGGGAATGGTCCCCCCTCCACTCCACAGAAAACCCTCCCC
ARiS109M24 pGCAP10 GGCTGTNCNNGACGCNNNCTCCCTCTGCACACAGTGCACGAAGACGCTGTCGGGAGAGCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl