Prev. |  KEGG KO K01330 > 

RIKEN DNA Bank Human Resource - C1R

Gene ID NCBI Gene 715 |  KEGG hsa:715
Gene Symbol C1R
Protein Name complement C1r
Synonyms EDSPD1
Featured content SARS-CoV-2 relevant human genes
Ortholog resource in our bank

  C1R

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX011876 IRAK029L12 pCMV-SPORT6 BC035220 NM_001733

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR182478 ARi56D06 pGCAP10 NM_001733.4  
GATTCCCTCCAACATTCCTCCGGGAATGGTCCCCCCTCCACTCCACAGAAAACCCTCCCC
HKR243912 ARiS109M24 pGCAP10 NM_001733.4  
GGCTGTNCNNGACGCNNNCTCCCTCTGCACACAGTGCACGAAGACGCTGTCGGGAGAGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl