Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07426

HP ID(1) HP07426
Gene ID(2) 55706
Gene Symbol finder TMEM48
Protein Name transmembrane protein 48
RefSeq NM_018087.3
Length of RefSeq (bp) 2541
Chromosome 1p32.3
Reference DDBJ accession
UniGene Hs.476525

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS109G21 pGCAP10 GGTCTCCTGTACGCCCTAGACTAGGGGCCGCCATCTCCATGGCCACGGCCGTGAGCCGGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl