Prev. |  KEGG KO K14315 > 

RIKEN DNA Bank Human Resource - NDC1

Gene ID NCBI Gene 55706 |  KEGG hsa:55706
Gene Symbol NDC1
Protein Name NDC1 transmembrane nucleoporin
Synonyms NET3|TMEM48
Ortholog resource in our bank

  NDC1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY083178 IRAL007P18 pOTB7 BC003082 NM_018087

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE097605 M01C044A05 pDONR221 MGC11-E03 BC003082 ENST00000371429  
HGE097653 M01C044C05 pDONR221 MGC11-E03 BC003082 ENST00000371429  
HGE097701 M01C044E05 pDONR221 MGC11-E03 BC003082 ENST00000371429  
HGE097749 M01C044G05 pDONR221 MGC11-E03 BC003082 ENST00000371429  
HGE097797 M01C044I05 pDONR221 MGC11-E03 BC003082 ENST00000371429  
HGE097845 M01C044K05 pDONR221 MGC11-E03 BC003082 ENST00000371429  
HGE097893 M01C044M05 pDONR221 MGC11-E03 BC003082 ENST00000371429  
HGE097941 M01C044O05 pDONR221 MGC11-E03 BC003082 ENST00000371429  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR243765 ARiS109G21 pGCAP10 NM_018087.3  
GGTCTCCTGTACGCCCTAGACTAGGGGCCGCCATCTCCATGGCCACGGCCGTGAGCCGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl