Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07422

HP ID(1) HP07422
Gene ID(2) 51112
Gene Symbol finder TTC15
Protein Name tetratricopeptide repeat domain 15?
RefSeq NM_016030.5
Length of RefSeq (bp) 2546
Chromosome 2p25.3
Reference DDBJ accession
UniGene Hs.252713

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS109E22 pGCAP10 GACCTTCCTCACGGACCTTGGTCACGGCCGCAGGTGACCCCTTAGCCCAGCTCCAGTGGG
RBd34G09 pGCAP10 GCCTCTCCGATTCCCGGCTTCTGTCACCTTCCTCACGGACCTTGGTCACGGCCGCAGGTG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl