Prev. |  KEGG KO K20309 > 

RIKEN DNA Bank Human Resource - TRAPPC12

Gene ID NCBI Gene 51112 |  KEGG hsa:51112
Gene Symbol TRAPPC12
Protein Name trafficking protein particle complex 12
Synonyms CGI-87|PEBAS|TTC-15|TTC15
Ortholog resource in our bank

  TRAPPC12

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY089398 IRAL023I06 pOTB7 BC017475 NM_016030 Partial
HGY092152 IRAL030G08 pOTB7 BC014164 NM_016030 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR243718 ARiS109E22 pGCAP10 NM_016030.5  
GACCTTCCTCACGGACCTTGGTCACGGCCGCAGGTGACCCCTTAGCCCAGCTCCAGTGGG
HKR373753 RBd34G09 pGCAP10 NM_016030.5  
GCCTCTCCGATTCCCGGCTTCTGTCACCTTCCTCACGGACCTTGGTCACGGCCGCAGGTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl