Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07411

HP ID(1) HP07411
Gene ID(2) 8986
Gene Symbol finder RPS6KA4
Protein Name ribosomal protein S6 kinase, 90kDa, polypeptide 4
RefSeq NM_003942.2
Length of RefSeq (bp) 3149
Chromosome 11q13.1
Reference DDBJ accession
UniGene Hs.105584

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi29E08 pGCAP10 GGGAGCCGCCATGTAACCGGCGCCGCCCGGAGCCCGAGCCGCGCGGGCCCCAGCGACCCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl