Prev. | NRCD Clone U | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07406

HP ID(1) HP07406
Gene ID(2) 7874
Gene Symbol finder USP7
Protein Name ubiquitin specific peptidase 7 (herpes virus-associated)
RefSeq NM_003470.2
Length of RefSeq (bp) 5412
Chromosome 16p13.3
Reference DDBJ accession
UniGene Hs.706830

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi28F07 pGCAP10 GGCTTGCTCTCCTCGCTCGCTCGCTCGCTCCGCGGCCCCCCATGCGGATGTGACATTTCA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl