Prev. |  KEGG KO K11838 > 

RIKEN DNA Bank Human Resource - USP7

Gene ID NCBI Gene 7874 |  KEGG hsa:7874
Gene Symbol USP7
Protein Name ubiquitin specific peptidase 7
Synonyms HAUSP|TEF1
Ortholog resources KEGG ortholog (KEGG orthology K11838) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR171327 ARi28F07 pGCAP10 NM_003470.2  
GGCTTGCTCTCCTCGCTCGCTCGCTCGCTCCGCGGCCCCCCATGCGGATGTGACATTTCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl