Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07388

HP ID(1) HP07388
Gene ID(2) 26277
Gene Symbol finder TINF2
Protein Name TERF1 (TRF1)-interacting nuclear factor 2
RefSeq NM_012461.2
Length of RefSeq (bp) 2196
Chromosome 14q12
Reference DDBJ accession
UniGene Hs.496191

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi26A06 pGCAP10 GGAGGCACCCTCGGGCTCGAGACAGCGGCGACGTTTAAAGCTGAGCGACCCAGTGCCACT
ARi45G03 pGCAP10 GAGTGCCACTGGAGACGGTCAGCTTCTCCACTCAGGCTCCTCCAGCCCGAGCCAGAAGAC
ARi58B07 pGCAP10 GGGAGCCCGCCGACCATGGCTACGCCCCTGGTGGCGGGTCCCGCAGCTCTACGCTTCGCC
ARiS122P18 pGCAP10 GAGACGGTCAGCTTCTCCACTCAGGCTCCTCCAGCCCGAGCCAGAAGACCCCCTCCCCCA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl