Prev. |  KEGG KO K11112 > 

RIKEN DNA Bank Human Resource - TINF2

Gene ID NCBI Gene 26277 |  KEGG hsa:26277
Gene Symbol TINF2
Protein Name TERF1 interacting nuclear factor 2
Synonyms DKCA3|TIN2
Ortholog resource in our bank

  TINF2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY087278 IRAL018D06 pOTB7 BC019343 NM_012461 Full/var
HGY087445 IRAL018K05 pOTB7 BC005030 NM_012461 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR170406 ARi26A06 pGCAP10 NM_012461.2  
GGAGGCACCCTCGGGCTCGAGACAGCGGCGACGTTTAAAGCTGAGCGACCCAGTGCCACT
HKR178147 ARi45G03 pGCAP10 NM_012461.2  
GAGTGCCACTGGAGACGGTCAGCTTCTCCACTCAGGCTCCTCCAGCCCGAGCCAGAAGAC
HKR183231 ARi58B07 pGCAP10 NM_012461.2  
GGGAGCCCGCCGACCATGGCTACGCCCCTGGTGGCGGGTCCCGCAGCTCTACGCTTCGCC
HKR249178 ARiS122P18 pGCAP10 NM_012461.2  
GAGACGGTCAGCTTCTCCACTCAGGCTCCTCCAGCCCGAGCCAGAAGACCCCCTCCCCCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl