Prev. | NRCD Clone U | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07386

HP ID(1) HP07386
Gene ID(2) 84749
Gene Symbol finder USP30
Protein Name ubiquitin specific peptidase 30
RefSeq NM_032663.3
Length of RefSeq (bp) 3766
Chromosome 12q24.11
Reference DDBJ accession
UniGene Hs.486434

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd29H02 pGCAP10 GGCTGTCTCGGGAACCGTCGTATCCCTCGGTCCGGCGGCGGCGGCGGCGGTAGCGGAGGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl