Prev. |  KEGG KO K11851 > 

RIKEN DNA Bank Human Resource - USP30

Gene ID NCBI Gene 84749 |  KEGG hsa:84749
Gene Symbol USP30
Protein Name ubiquitin specific peptidase 30
Synonyms -
Ortholog resources KEGG ortholog (KEGG orthology K11851) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY084602 IRAL011I10 pOTB7 BC022094 NM_032663 Partial
HGY085783 IRAL014H15 pOTB7 BC004868 NM_032663

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE098414 M01C046A14 pDONR221 MGC12-F07 BC004868 ENST00000377883  
HGE098462 M01C046C14 pDONR221 MGC12-F07 BC004868 ENST00000377883  
HGE098510 M01C046E14 pDONR221 MGC12-F07 BC004868 ENST00000377883  
HGE098558 M01C046G14 pDONR221 MGC12-F07 BC004868 ENST00000377883  
HGE098606 M01C046I14 pDONR221 MGC12-F07 BC004868 ENST00000377883  
HGE098654 M01C046K14 pDONR221 MGC12-F07 BC004868 ENST00000377883 done
HGE098702 M01C046M14 pDONR221 MGC12-F07 BC004868 ENST00000377883  
HGE098750 M01C046O14 pDONR221 MGC12-F07 BC004868 ENST00000377883  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR371770 RBd29H02 pGCAP10 NM_032663.3  
GGCTGTCTCGGGAACCGTCGTATCCCTCGGTCCGGCGGCGGCGGCGGCGGTAGCGGAGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl