Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07357

HP ID(1) HP07357
Gene ID(2) 5298
Gene Symbol finder PI4KB
Protein Name phosphatidylinositol 4-kinase, catalytic, beta
RefSeq NM_002651.1
Length of RefSeq (bp) 3471
Chromosome 1q21
Reference DDBJ accession
UniGene Hs.632465

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS020G18 pGCAP10 GAGCCGGGGCCTGGTGCAGCCTCCGCGGCCGCTGTCAGGGAAGCGCAGGCGGCCAATGGA
RBd26D05 pGCAP10 GGTGCAGCCTCCGCGGCCGCTGTCAGGGAAGCGCAGGCGGCCAATGGAACCCGGGAGCGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl