Prev. |  KEGG KO K19801 > 

RIKEN DNA Bank Human Resource - PI4KB

Gene ID NCBI Gene 5298 |  KEGG hsa:5298
Gene Symbol PI4KB
Protein Name phosphatidylinositol 4-kinase beta
Synonyms NPIK|PI4K-BETA|PI4K92|PI4KBETA|PI4KIII|PI4KIIIBETA|PIK4CB
Featured content Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.
Ortholog resource in our bank

  PI4KB

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY083170 IRAL007P10 pOTB7 BC000029 NM_002651 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE097236 M01C043B12 pDONR221 MGC11-D06 BC000029 ENST00000368874  
HGE097284 M01C043D12 pDONR221 MGC11-D06 BC000029 ENST00000368874  
HGE097332 M01C043F12 pDONR221 MGC11-D06 BC000029 ENST00000368874  
HGE097380 M01C043H12 pDONR221 MGC11-D06 BC000029 ENST00000368874  
HGE097428 M01C043J12 pDONR221 MGC11-D06 BC000029 ENST00000368874  
HGE097476 M01C043L12 pDONR221 MGC11-D06 BC000029 ENST00000368874  
HGE097524 M01C043N12 pDONR221 MGC11-D06 BC000029 ENST00000368874  
HGE097572 M01C043P12 pDONR221 MGC11-D06 BC000029 ENST00000368874  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR208162 ARiS020G18 pGCAP10 NM_002651.1  
GAGCCGGGGCCTGGTGCAGCCTCCGCGGCCGCTGTCAGGGAAGCGCAGGCGGCCAATGGA
HKR370477 RBd26D05 pGCAP10 NM_002651.1 VA done
GGTGCAGCCTCCGCGGCCGCTGTCAGGGAAGCGCAGGCGGCCAATGGAACCCGGGAGCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl