Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07348

HP ID(1) HP07348
Gene ID(2) 56133
Gene Symbol finder PCDHB2
Protein Name protocadherin beta 2
RefSeq NM_018936.2
Length of RefSeq (bp) 2733
Chromosome 5q31
Reference DDBJ accession
UniGene Hs.533023

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd25B03 pGCAP10 GAGTATCAGCGAGATACGGGGAGATAGAGTTAGCGACAACGTGAGCCAGAGCTGGAGCAC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl