Prev. |  KEGG KO K16494 > 

RIKEN DNA Bank Human Resource - PCDHB2

Gene ID NCBI Gene 56133 |  KEGG hsa:56133
Gene Symbol PCDHB2
Protein Name protocadherin beta 2
Synonyms PCDH-BETA2
Ortholog resources KEGG ortholog (KEGG orthology K16494) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR370027 RBd25B03 pGCAP10 NM_018936.2  
GAGTATCAGCGAGATACGGGGAGATAGAGTTAGCGACAACGTGAGCCAGAGCTGGAGCAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl