Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07347

HP ID(1) HP07347
Gene ID(2) 219899
Gene Symbol finder TBCEL
Protein Name tubulin folding cofactor E-like
RefSeq NM_152715.3
Length of RefSeq (bp) 4041
Chromosome 11q23.3
Reference DDBJ accession
UniGene Hs.504136

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi50G04 pGCAP10 GACTGGGCTCCGGCGGCCAGAGTGGGGGACTAGGTGAAGCGGCGCCGGGCCGGGGCTGGC
RBd24H10 pGCAP10 TGGTTNNCGGGTCAATGCACGACACTGGGCTCCGGCGGCCAGAGTGGGGGACTAGGTGAA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl