Prev. | 

RIKEN DNA Bank Human Resource - TBCEL

Gene ID NCBI Gene 219899 |  KEGG hsa:219899
Gene Symbol TBCEL
Protein Name tubulin folding cofactor E like
Synonyms El|LRRC35
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX009042 IRAK022K02 pCMV-SPORT6 BC020501 NM_152715 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR180148 ARi50G04 pGCAP10 NM_152715.3  
GACTGGGCTCCGGCGGCCAGAGTGGGGGACTAGGTGAAGCGGCGCCGGGCCGGGGCTGGC
HKR369778 RBd24H10 pGCAP10 NM_152715.3  
TGGTTNNCGGGTCAATGCACGACACTGGGCTCCGGCGGCCAGAGTGGGGGACTAGGTGAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl