Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07337

HP ID(1) HP07337
Gene ID(2) 26155
Gene Symbol finder NOC2L
Protein Name nucleolar complex associated 2 homolog (S. cerevisiae)
RefSeq NM_015658.3
Length of RefSeq (bp) 2817
Chromosome 1p36.33
Reference DDBJ accession
UniGene Hs.405987

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd23F03 pGCAP10 GGGGTTGGTGTCATGGCAGCTGCGGGGAGCCGCAAGAGGCGCCTGGCGGAGCTGACGGTG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl