Prev. |  KEGG KO K14833 > 

RIKEN DNA Bank Human Resource - NOC2L

Gene ID NCBI Gene 26155 |  KEGG hsa:26155
Gene Symbol NOC2L
Protein Name NOC2 like nucleolar associated transcriptional repressor
Synonyms NET15|NET7|NIR|PPP1R112
Ortholog resource in our bank

  NOC2L

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY083238 IRAL008B14 pOTB7 BC003555 NM_015658 Full/var
HGY087821 IRAL019J05 pDNR-LIB BC009786 NM_015658 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE017524 W01A043N12 pENTR-TOPO IRAL008B14 BC003555 NM_015658  
HGE017528 W01A043N16 pENTR-TOPO IRAL008B14 BC003555 NM_015658  
HGE017530 W01A043N18 pENTR-TOPO IRAL008B14 BC003555 NM_015658  
HGE017532 W01A043N20 pENTR-TOPO IRAL008B14 BC003555 NM_015658  
HGE017534 W01A043N22 pENTR-TOPO IRAL008B14 BC003555 NM_015658  
HGE017536 W01A043N24 pENTR-TOPO IRAL008B14 BC003555 NM_015658  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR369323 RBd23F03 pGCAP10 NM_015658.3  
GGGGTTGGTGTCATGGCAGCTGCGGGGAGCCGCAAGAGGCGCCTGGCGGAGCTGACGGTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl