Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NOC2L

Gene ID (NCBI) 26155
Gene Symbol NOC2L
Protein Name nucleolar complex associated 2 homolog (S. cerevisiae)
Synonyms NET15|NET7|NIR
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY083238 IRAL008B14 pOTB7 BC003555 NM_015658 Full/var
HGY087821 IRAL019J05 pDNR-LIB BC009786 NM_015658 Partial

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA
Clone ID Sequence (DDBJ)
HGE017524 W01A043N12 pENTR-TOPO IRAL008B14 BC003555 NM_015658
HGE017528 W01A043N16 pENTR-TOPO IRAL008B14 BC003555 NM_015658
HGE017530 W01A043N18 pENTR-TOPO IRAL008B14 BC003555 NM_015658
HGE017532 W01A043N20 pENTR-TOPO IRAL008B14 BC003555 NM_015658
HGE017534 W01A043N22 pENTR-TOPO IRAL008B14 BC003555 NM_015658
HGE017536 W01A043N24 pENTR-TOPO IRAL008B14 BC003555 NM_015658

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR369323 RBd23F03 pGCAP10 NM_015658.3
GGGGTTGGTGTCATGGCAGCTGCGGGGAGCCGCAAGAGGCGCCTGGCGGAGCTGACGGTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.11

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl