Prev. | NRCD Clone B | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07316

HP ID(1) HP07316
Gene ID(2) 648
Gene Symbol finder BMI1
Protein Name BMI1 polycomb ring finger oncogene
RefSeq NM_005180.6
Length of RefSeq (bp) 3568
Chromosome 10p11.23
Reference DDBJ accession
UniGene Hs.380403

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS013I19 pGCAP10 GGCAGAATAAAACCGATCGCGCCCCCTCCGCGCGCGCCCTCCCCCGAGTGCGGAGCGGGA
ARiS096D06 pGCAP10 GGCCGAGGCTCGGGGCTCGGGCCGGGCTCCGCGCGGAGTTGCAGCGGTGGCCGGATGCCA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl