Prev. |  KEGG KO K11459 > 

RIKEN DNA Bank Human Resource - BMI1

Gene ID NCBI Gene 648 |  KEGG hsa:648
Gene Symbol BMI1
Protein Name BMI1 proto-oncogene, polycomb ring finger
Synonyms FLVI2/BMI1|PCGF4|RNF51|flvi-2/bmi-1
Featured content Signaling pathways regulating pluripotency of stem cells (human)
Ortholog resource in our bank

  BMI1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB12880 CSIV-TRE-hBmi1-CMV-KT
RDB12881 CSIV-CMV-hBmi1-IRES2-Venus

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY087058 IRAL017K18 pOTB7 BC011652 NM_005180

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE009243 W01A023B19 pENTR-TOPO IRAL017K18 BC011652 NM_005180 done

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR205411 ARiS013I19 pGCAP10 NM_005180.6  
GGCAGAATAAAACCGATCGCGCCCCCTCCGCGCGCGCCCTCCCCCGAGTGCGGAGCGGGA
HKR238478 ARiS096D06 pGCAP10 NM_005180.6  
GGCCGAGGCTCGGGGCTCGGGCCGGGCTCCGCGCGGAGTTGCAGCGGTGGCCGGATGCCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl