Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07304

HP ID(1) HP07304
Gene ID(2) 79716
Gene Symbol finder NPEPL1
Protein Name aminopeptidase-like 1
RefSeq NM_024663.3
Length of RefSeq (bp) 2217
Chromosome 20q13.32
Reference DDBJ accession
UniGene Hs.654868

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS013D10 pGCAP10 GGGGCCGGAGCGGGGCGAAGGGGGCCGAGCGGCGGGCCGGGCCGGGCCGGGCAGGGCCGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl