Prev. |  KEGG KO K09611 > 

RIKEN DNA Bank Human Resource - NPEPL1

Gene ID NCBI Gene 79716 |  KEGG hsa:79716
Gene Symbol NPEPL1
Protein Name aminopeptidase like 1
Synonyms bA261P9.2
Ortholog resource in our bank

  NPEPL1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX009000 IRAK022I08 pCMV-SPORT6 BC020507 NM_024663 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE117243 M01C093B19 pDONR221 IMS10-C10 AK124059 XM_928465  
HGE117291 M01C093D19 pDONR221 IMS10-C10 AK124059 XM_928465  
HGE117339 M01C093F19 pDONR221 IMS10-C10 AK124059 XM_928465  
HGE117387 M01C093H19 pDONR221 IMS10-C10 AK124059 XM_928465  
HGE117435 M01C093J19 pDONR221 IMS10-C10 AK124059 XM_928465  
HGE117483 M01C093L19 pDONR221 IMS10-C10 AK124059 XM_928465  
HGE117531 M01C093N19 pDONR221 IMS10-C10 AK124059 XM_928465  
HGE117579 M01C093P19 pDONR221 IMS10-C10 AK124059 XM_928465  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR205282 ARiS013D10 pGCAP10 NM_024663.3  
GGGGCCGGAGCGGGGCGAAGGGGGCCGAGCGGCGGGCCGGGCCGGGCCGGGCAGGGCCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl