Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NPEPL1

Gene ID (NCBI) 79716
Gene Symbol NPEPL1
Protein Name aminopeptidase-like 1
Synonyms bA261P9.2
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX009000 IRAK022I08 pCMV-SPORT6 BC020507 NM_024663 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA
Clone ID Sequence (DDBJ)
HGE117243 M01C093B19 pDONR221 IMS10-C10 AK124059 XM_928465
HGE117291 M01C093D19 pDONR221 IMS10-C10 AK124059 XM_928465
HGE117339 M01C093F19 pDONR221 IMS10-C10 AK124059 XM_928465
HGE117387 M01C093H19 pDONR221 IMS10-C10 AK124059 XM_928465
HGE117435 M01C093J19 pDONR221 IMS10-C10 AK124059 XM_928465
HGE117483 M01C093L19 pDONR221 IMS10-C10 AK124059 XM_928465
HGE117531 M01C093N19 pDONR221 IMS10-C10 AK124059 XM_928465
HGE117579 M01C093P19 pDONR221 IMS10-C10 AK124059 XM_928465

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR205282 ARiS013D10 pGCAP10 NM_024663.3
GGGGCCGGAGCGGGGCGAAGGGGGCCGAGCGGCGGGCCGGGCCGGGCCGGGCAGGGCCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.10

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl