Prev. | NRCD Clone O | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07291

HP ID(1) HP07291
Gene ID(2) 28962
Gene Symbol finder OSTM1
Protein Name osteopetrosis associated transmembrane protein 1
RefSeq NM_014028.3
Length of RefSeq (bp) 4467
Chromosome 6q21
Reference DDBJ accession
UniGene Hs.719130

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS008M13 pGCAP10 TGGCCGGCTGGGGGCGGAGAGGCGGCGGTGGGCTCCCTGGGGTGTGTGAGCCCGGTGATG
ARiS191G03 pGCAP10 GGGCTGTCCGCGGTGCCGGCTGGGGGCGGAGAGGCGGCGGTGGGCTCCCTGGGGTGTGTG
RBdS132F06 pGCAP10 GGGCTGTCCGCGGTGCCGGCTGGGGGCGGAGAGGCGGCGGTGGGCTCCCTGGGGTGTGTG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl