Prev. | 

RIKEN DNA Bank Human Resource - OSTM1

Gene ID NCBI Gene 28962 |  KEGG hsa:28962
Gene Symbol OSTM1
Protein Name osteopetrosis associated transmembrane protein 1
Synonyms GIPN|GL|HSPC019|OPTB5
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY067318 IRAK168E22 pBluescriptR BC068581 NM_014028 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE084040 M01C010B16 pDONR221 FLJ02-H08 AK129854 NM_014028  
HGE084088 M01C010D16 pDONR221 FLJ02-H08 AK129854 NM_014028  
HGE084136 M01C010F16 pDONR221 FLJ02-H08 AK129854 NM_014028  
HGE084184 M01C010H16 pDONR221 FLJ02-H08 AK129854 NM_014028  
HGE084232 M01C010J16 pDONR221 FLJ02-H08 AK129854 NM_014028  
HGE084280 M01C010L16 pDONR221 FLJ02-H08 AK129854 NM_014028  
HGE084328 M01C010N16 pDONR221 FLJ02-H08 AK129854 NM_014028  
HGE084376 M01C010P16 pDONR221 FLJ02-H08 AK129854 NM_014028  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE014424 W01A036A24 pENTR-TOPO IRAK168E22 BC068581 NM_014028  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR203501 ARiS008M13 pGCAP10 NM_014028.3  
TGGCCGGCTGGGGGCGGAGAGGCGGCGGTGGGCTCCCTGGGGTGTGTGAGCCCGGTGATG
HKR276547 ARiS191G03 pGCAP10 NM_014028.3  
GGGCTGTCCGCGGTGCCGGCTGGGGGCGGAGAGGCGGCGGTGGGCTCCCTGGGGTGTGTG
HKR452926 RBdS132F06 pGCAP10 NM_014028.3  
GGGCTGTCCGCGGTGCCGGCTGGGGGCGGAGAGGCGGCGGTGGGCTCCCTGGGGTGTGTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl