Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07274

HP ID(1) HP07274
Gene ID(2) 23216
Gene Symbol finder TBC1D1
Protein Name TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1
RefSeq NM_015173.2
Length of RefSeq (bp) 5688
Chromosome 4p14
Reference DDBJ accession
UniGene Hs.176503

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS008E12 pGCAP10 GCTCTTCGGCTGCTGCTCCTGGTGCCGCCACCGTCCGCCGGTGCCTGTTGCTGCCGCCGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl