DNA Bank Top |  KEGG KO K18341 > 

RIKEN DNA Bank Human Resource - TBC1D1

Gene ID NCBI Gene 23216 |  KEGG hsa:23216
Gene Symbol TBC1D1
Protein Name TBC1 domain family member 1
Synonyms TBC|TBC1

Link

Ortholog resource in our bank

  TBC1D1

External database

human TBC1D1

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB14982 pEGFP-C1-human TBC1D1 Expression vector of human TBC1 domain family member 1 (TBC1D1), fused with N-terminal EGFP, CMV promoter.    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY036328 IRAK090N16 pBluescript BC050321 NM_015173 Full/var
HGX046131 IRAK115F11 pCMV-SPORT6 BC053648 NM_015173 Partial
HGY085664 IRAL014C16 pOTB7 BC014529 NM_015173 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE044263 W01A110K23 pENTR-TOPO IRAK090N16 BC050321 NM_015173  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2024May11.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR203308 ARiS008E12 pGCAP10 NM_015173.2  
GCTCTTCGGCTGCTGCTCCTGGTGCCGCCACCGTCCGCCGGTGCCTGTTGCTGCCGCCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv

2024.09.29

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl