Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07273

HP ID(1) HP07273
Gene ID(2) 7030
Gene Symbol finder TFE3
Protein Name transcription factor binding to IGHM enhancer 3
RefSeq NM_006521.3
Length of RefSeq (bp) 3431
Chromosome Xp11.22
Reference DDBJ accession
UniGene Hs.274184

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi45H06 pGCAP10 GCCCCCGACGCCGCCCGCCCGCGCAGTGCTAGCTCCATGGCTTAGCGGAGGAGGCGGCAG
ARiS008E09 pGCAP10 GGTGCTAGCTCCANNNCTTAGCGGAGGAGGCGGCAGTGGCGAGCTGGGGGGAGGGGGGAC
ARiS013G10 pGCAP10 GAGTGGCGAGCTGGGGGGAGGGGGGACTCTTATTTTGTTAGGGGGACCGGGCCGAGGCCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl